IthaID: 161



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 53/54 (+G) HGVS Name: HBB:c.163dupG
Hb Name: N/A Protein Info: β 54(+G); modified C-terminal sequence: (54)Gly-Tyr-Gly-Gln-(58)Pro-COOH

Context nucleotide sequence:
TGGGGATCTGTCCACTCCTGATGCTG [-/G] TTATGGGCAACCCTAAGGTGAAGG (Strand: -)

Also known as:

Comments: The introduction of a nt G between codons 53 and 54 (GCTGTT>GCTGGTT) leads to a frameshift with a stop codon at codon 59 (TGA) and premature termination of translation.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70887
Size: 1 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Japanese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Fucharoen S, Katsube T, Fucharoen G, Sawada H, Oishi H, Katsuno M, Nishimura J, Motomura S, Miura Y, Fukumaki Y, Molecular heterogeneity of beta-thalassaemia in the Japanese: identification of two novel mutations., British journal of haematology, 74(1), 101-7, 1990 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-12 16:18:51 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.