IthaID: 196
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 95 (+A) | HGVS Name: | HBB:c.287dupA |
| Hb Name: | N/A | Protein Info: | β 95(+A); modified C-terminal sequence: (95)Lys-Ala-Ala-Arg-Gly-Ser-(101)COOH |
Context nucleotide sequence:
CACTGAGTGAGCTGCACTGTGACAA [-/A] GCTGCACGTGGATCCTGAGAACTTC (Strand: -)
Also known as:
Comments: Found in one Thai beta-thalassemia/HbE patient [PMID: 1515453]. Found in two Vietnamese families. Found in a heterozygous state in the mother and in combination with a β0 allele (codon 17 nonsense) in her four children in the first family. Found in a heterozygous state in the father and in combination with Hb E in one child in the second family. The introduction of a nt A in codon 95 (AAG>AAAG), or between codons 94 (GAC) and 95 (AAG), changes the reading frame with termination of translation at codon 101 (TGA).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71011 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Thai | Vietnamese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Winichagoon P, Fucharoen S, Wilairat P, Chihara K, Fukumaki Y, Wasi P, Identification of five rare mutations including a novel frameshift mutation causing beta zero-thalassemia in Thai patients with beta zero-thalassemia/hemoglobin E disease., Biochimica et biophysica acta, 1139(4), 280-6, 1992 PubMed
- Cai S, Chehab FF, New frameshift mutation, insertion of A, at codon 95 of the beta-globin gene causes beta-thalassemia in two Vietnamese families., Human mutation, 8(3), 293-4, 1996 PubMed
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2014-04-24 16:50:38 | The IthaGenes Curation Team | Reviewed. Added ClinVar link. |
| 4 | 2019-11-12 10:37:30 | The IthaGenes Curation Team | Reviewed. HGVS name corrected. Comment added. |
| 5 | 2019-11-12 10:38:25 | The IthaGenes Curation Team | Reviewed. Origin corrected. |