IthaID: 2120
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | -495 (A>T) | HGVS Name: | NG_023030.1:g.4613A>T |
Context nucleotide sequence:
AAGTTCCTGATGTTGCCCACCAGGCT [A/T] TTGCTCTGAGCAGCGCTGCCTCCCA (Strand: +)
Also known as: rs2071746
Comments: HMOX1-413 A>T associated with less frequent vaso-occlusive crisis (VOC)/lifetime, less VOC in the last year, less incidence of stroke, less frequency of hospitalization, and responded more frequently to hydroxyurea with statistically significant differences among Egyptian sickle cell disease (SCD) patients. Also, the T allele associated with higher levels of HbF in SCD patients from Brazil, Iran and India, but not in an Egyptian SCD cohort.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] Stroke [HP:0001297] [OMIM:601367] Vaso-occlusive crisis |
Location
Chromosome: | 22 |
---|---|
Locus: | NG_023030.1 |
Locus Location: | 4613 |
Size: | 1 bp |
Located at: | HMOX1 |
Specific Location: | Promoter |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Brazilian, Iranian, Egyptian, Indian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Gil GP, Ananina G, Oliveira MB, Costa FF, Silva MJ, Santos MN, Bezerra MA, Hatzlhofer BL, Araujo AS, Melo MB, Polymorphism in the HMOX1 gene is associated with high levels of fetal hemoglobin in Brazilian patients with sickle cell anemia., Hemoglobin , 37(4), 315-24, 2013 PubMed
- Bakr S, Khorshied M, Talha N, Jaffer KY, Soliman N, Eid K, El-Ghamrawy M, Implication of HMOX1 and CCR5 genotypes on clinical phenotype of Egyptian patients with sickle cell anemia., Ann. Hematol., 2019 PubMed
- Hariharan P, Chavan V, Nadkarni A, Significance of heme oxygenase-1(HMOX1) gene on fetal hemoglobin induction in sickle cell anemia patients., Sci Rep, 10(1), 18506, 2020 PubMed
Created on 2013-09-19 13:19:31,
Last reviewed on 2020-11-12 08:48:01 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2013-09-19 13:19:31 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
3 | 2019-06-26 14:26:06 | The IthaGenes Curation Team | Reviewed. Reference added. Clinical phenotypes and Origin added, and Comment updated |
4 | 2019-06-26 14:26:40 | The IthaGenes Curation Team | Reviewed. |
5 | 2019-06-26 14:27:39 | The IthaGenes Curation Team | Reviewed. Reference added. |
6 | 2020-11-12 08:48:01 | The IthaGenes Curation Team | Reviewed. Reference added. Comment and Origin fields updated. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-18 10:10:45