IthaID: 2128

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs10128556	HGVS Name:	NG_000007.3:g.55163G>A

Context nucleotide sequence:
TCCTATCCTTCTCTTACTTGCTATG [C/T] CAACTCACTACCCCAACATATTGTG (Strand: +)

Also known as:

Comments: Variation associated with HbF levels in the Cooperative Study of Sickle Cell Disease (CSSCD; n=1032). Reported weak association in individuals from Thailand with HbE/β0-thalassemia (mild disease group, n=207), and strong association with disease severity. Reported to influence HbF expression levels in Saudi patients with sickle cell disease (SCD). The C allele associated with HbF levels in Kuwaiti patients with SCD, specifically in patients with up to 30% HbF but not beyond. It also identifies the RFLP site HincII in the beta-globin gene cluster for the characterization of βS haplotypes (Benin, Bantu, Senegal, Cameroon, Arab-Indian).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Hb F levels [HP:0011904] [OMIM:141749] Severity [HP:0012824]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	55163
Size:	1 bp
Located at:	pseudo β
Specific Location:	N/A

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	African American, Thai, Saudi, Kuwaiti
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Galarneau G, Palmer CD, Sankaran VG, Orkin SH, Hirschhorn JN, Lettre G, Fine-mapping at three loci known to affect fetal hemoglobin levels explains additional genetic variation., Nat. Genet. , 42(12), 1049-51, 2010 PubMed
Sherva R, Sripichai O, Abel K, Ma Q, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Svasti S, Fucharoen S, Braun A, Farrer LA, Genetic modifiers of Hb E/beta0 thalassemia identified by a two-stage genome-wide association study., BMC Med. Genet. , 11(0), 51, 2010 PubMed
Vathipadiekal V, Alsultan A, Baltrusaitis K, Farrell JJ, Al-Rubaish AM, Al-Muhanna F, Naserullah Z, Suliman A, Patra PK, Milton JN, Farrer LA, Chui DH, Al-Ali AK, Sebastiani P, Steinberg MH, Homozygosity for a haplotype in the HBG2-OR51B4 region is exclusive to Arab-Indian haplotype sickle cell anemia., Am. J. Hematol. , 91(6), E308-11, 2016 PubMed
Shaikho EM, Farrell JJ, Alsultan A, Qutub H, Al-Ali AK, Figueiredo MS, Chui DHK, Farrer LA, Murphy GJ, Mostoslavsky G, Sebastiani P, Steinberg MH, A phased SNP-based classification of sickle cell anemia HBB haplotypes., BMC Genomics, 18(1), 608, 2017 PubMed
Akbulut-Jeradi N, Fernandez MJ, Al Khaldi R, Sukumaran J, Adekile A, Unique Polymorphisms at , and Loci Associated with HbF in Kuwaiti Patients with Sickle Cell Disease., J Pers Med, 11(6), , 2021 PubMed

Created on 2013-09-24 12:47:20, Last reviewed on 2021-12-21 12:29:17 (Show full history)

A/A	Date	Curator(s)	Comments
1	2013-09-24 12:47:20	The IthaGenes Curation Team	Created
2	2013-10-15 17:00:14	The IthaGenes Curation Team	Reviewed.
3	2014-04-23 18:53:43	The IthaGenes Curation Team	Reviewed. Reference added.
4	2016-05-16 17:15:44	The IthaGenes Curation Team	Reviewed.
5	2016-05-18 15:42:41	The IthaGenes Curation Team	Reviewed.
6	2016-05-25 10:07:25	The IthaGenes Curation Team	Reviewed.
7	2016-05-25 10:11:53	The IthaGenes Curation Team	Reviewed.
8	2016-08-10 09:18:10	The IthaGenes Curation Team	Reviewed. Update of mutation characterization.
9	2016-08-10 09:34:24	The IthaGenes Curation Team	Reviewed.
10	2020-04-22 13:48:23	The IthaGenes Curation Team	Reviewed. Comment updated. Reference added.
11	2021-07-09 14:10:10	The IthaGenes Curation Team	Reviewed. Phenotype added.
12	2021-12-21 12:29:17	The IthaGenes Curation Team	Reviewed. Reference added. Comment updated.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.