IthaID: 2463



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: TTS +99 C>C HGVS Name: HBB:c.*233G>C
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
TGAAGAGCTAGTTCAAACCTT [C/G] GGAAAATACACTATATCTTAAA (Strand: -)

Also known as:

Comments: This variant was described in a cohort of Palestinians with β-thal trait or disease as a possible β+ allele [PMID: 23321370]. Nevertheless, a subsequent study investigating 18 individuals with the HBB:c.*233G>C variant gave no evidence for pathogenicity, strongly suggesting that it is not associated with a β-thal phenotype [PMID: 26524961].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72251
Size: 1 bp
Located at: β
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Other 3'UTR site (mRNA Processing)
Ethnic Origin: Palestinian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Sirdah MM, Sievertsen J, Al-Yazji MS, Tarazi IS, Al-Haddad RM, Horstmann RD, Timmann C, The spectrum of β-thalassemia mutations in Gaza Strip, Palestine., Blood Cells Mol. Dis. , 50(4), 247-51, 2013 PubMed
  2. Smith DL, Mitui M, Park JY, Luu HS, Timmons CF, Characterization of the HBB: c.*233G > C Variant: No Evidence of a β-Thalassemic Phenotype., Hemoglobin , 40(1), 25-8, 2016 PubMed
Created on 2014-06-03 15:35:00, Last reviewed on 2021-02-12 15:25:04 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.