IthaID: 2527



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 114 (+CC) HGVS Name: HBA2:c.344_345dup
Hb Name: N/A Protein Info: α2 115(+CC); modified C-terminal sequence: (114)Pro-Pro-Pro-Ser-Ser-Pro-Leu-Arg-Cys-Thr-Pro-Pro-Trp-Thr-Ser-Ser-Trp-Leu-Leu-(133)COOH

Context nucleotide sequence:
GCTGGTGACCCTGGCCGCCCACCTC [-/CC] CCGCCGAGTTCACCCCTGCGGTGCA (Strand: +)

Also known as:

Comments: The mutation causes a frameshift that results in a premature stop codon at amino acid 134. Sequencing results revealed a CC insertion within a repeat of four cytosines. This insertion probably gives rise to a dominant alpha-thalassemic mutation considering the probable absence of protein expression and the very low hematologic parameters of the heterozygous child. Patient and his father presented with severe microcytosis and hypochromia and elevated erythrocytes values.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Dominant
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34378
Size: 2 bp
Located at: α2
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Greek
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Saller E, Dutly F, Frischknecht H, Two novel α2 gene mutations causing altered amino acid sequences produce a mild (Hb Kinshasa, HBA2: c.428A > T) and severe (HBA2: c.342-345insCC) α-thalassemia phenotype., Hemoglobin , 39(2), 144-6, 2015 PubMed
Created on 2014-10-09 11:31:45, Last reviewed on 2023-08-09 11:00:39 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.