IthaID: 2539
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | IVS II-3 (+21bp) | HGVS Name: | HBA1:c.283_300+3dup |
Hb Name: | Hb SKMC | Protein Info: | α1 nt 437 - α1 nt 457 inserted between nts 454 and 455 of α1 |
Context nucleotide sequence:
TCAACTTCAAGGTG [-/GACCCGGTCAACTTCAAGGTG] AGCGGCGGGCCGG (Strand: +)
Also known as:
Comments: The heterozygous form of the insertion produces small amount of unstable haemoglobin (Hb) with no specific effect on Hb level and RBC indices, but double heterozygote with other trait presenting mutations can increase unstable Hb production in a manner that presents with severe anemia.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia, α-chain variant |
Allele Phenotype: | α⁺ |
Stability: | Unstable |
Oxygen Affinity: | N/A |
Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 37979 |
Size: | 21 bp |
Located at: | α1 |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Insertion) |
---|---|
Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
Ethnic Origin: | Iranian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Waye JS, Eng B, Patterson M, Carcao MD, Chang L, Olivieri NF, Chui DH, Identification of two new alpha-thalassemia mutations in exon 2 of the alpha1-globin gene., Hemoglobin, 25(4), 391-6, 2001 PubMed
- Farashi S, Faramarzi Garous N, Zeinali F, Vakili S, Ashki M, Imanian H, Najmabadi H, Azarkeivan A, Tamaddoni A, A 21 Nucleotide Duplication on the α1- and α2-Globin Genes Involves a Variety of Hypochromic Microcytic Anemias, From Mild to Hb H Disease., Hemoglobin , 39(3), 196-200, 2015 PubMed
- Zekavat OR, Dehghani SJ, Imanifard J, Dehbozorgian J, Zareifar S, Haghpanah S, Introduction of novel α1-hemoglobin gene mutation with transfusion-dependent phenotype., Hematology , 2016 PubMed
Created on 2015-01-08 16:05:41,
Last reviewed on 2021-10-21 15:54:38 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2015-01-08 16:05:41 | The IthaGenes Curation Team | Created |
2 | 2016-09-09 13:26:29 | The IthaGenes Curation Team | Reviewed. Haemoglobinpathy status updated. Allele thal phenotype, clinical phenotype and reference added. Confirmed by sequencing. |
3 | 2021-10-21 15:54:38 | The IthaGenes Curation Team | Reviewed. HGVS name corrected. Reference added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-03-28 09:17:36