IthaID: 2593

Context nucleotide sequence:
CAAGCTCACGGATGTGGCCCCTGTA [A/G] GCTTCTTTCTTGTGCTGGATGTAGT (Strand: +)

Protein sequence:
MEGAALLRVSVLCIWMSALFLGVGVRAEEAGARVQQNVPSGTDTGDPQSKPLGDWAAGTMDPESSIFIEDAIKYFKEKVSTQNLLLLLTDNEAWNGFVAAAELPRNEADELRKALDNLARQMIMKDKNWHDKGQQYRNWFLKEFPRLKSELEDNIRRLRALADGVQKVHKGTTIANVVSGSLSISSGILTLVGMGLAPFTEGGSLVLLEPGMELGITAALTGITSSTMDYGKKWWTQAQAHDLVIKSLDKLKEVREFLGENISNFLSLAGNTYQLTRGIGKDIRALRRARANLQSVPHASASRPRVTEPISAESGEQVERVNEPSILEMSRGVKLTDVAPVGFFLVLDVVYLVYESKHLHEGAKSETAEELKKVAQELEEKLNILNNNYKILQADQEL

Also known as: APOL1 G1

Comments: SNP associated with proteinuria in individuals with sickle cell disease (SCD) acquired from the Duke University Medical Center, the University of North Carolina at Chapel Hill, the East Carolina University and the Emory University Sickle Cell Centers (n=521) [PMID: 21910715]. This SNP is in strong linkage disequilibrium (LD) with rs60910145 and shown to associate with focal segmental glomerulosclerosis (FSGS) in African American patients with SCD [PMID: 20647424]. SNP associated with an increased risk of albuminuria in SCD pediatric cohorts acquired from the HUSTLE (Hydroxyurea Study of Long-termEffects) and TWiTCH (TCD With Transfusions Changing to Hydroxyurea) clinical trials [PMID: 27711207]. SNP (APOL1 G1/G1 or G1/G2 genotypes) associated with a higher risk of end-stage renal disease, as well as with albuminuria, proteinuria and a lower estimated glomerular filtration rate (eGFR) in SCD adult patients of Sub-Saharan ancestry [PMID: 28699644]. SNP associated with the occurrence of small vessel disease (SVD) ischemic stroke among indigenous West African participants in the Stroke Investigative Research and Education Network (SIREN) Study [PMID: 28975602], but no study has as yet reported a similar association among patients affected with a haemoglobinopathy.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Heterozygous records (preview in IthaPhen)

1. Genovese G, Friedman DJ, Ross MD, Lecordier L, Uzureau P, Freedman BI, Bowden DW, Langefeld CD, Oleksyk TK, Uscinski Knob AL, Bernhardy AJ, Hicks PJ, Nelson GW, Vanhollebeke B, Winkler CA, Kopp JB, Pays E, Pollak MR, Association of trypanolytic ApoL1 variants with kidney disease in African Americans., Science , 329(5993), 841-5, 2010 PubMed
2. Ashley-Koch AE, Okocha EC, Garrett ME, Soldano K, De Castro LM, Jonassaint JC, Orringer EP, Eckman JR, Telen MJ, MYH9 and APOL1 are both associated with sickle cell disease nephropathy., Br. J. Haematol. , 155(3), 386-94, 2011 PubMed
3. Schaefer BA, Flanagan JM, Alvarez OA, Nelson SC, Aygun B, Nottage KA, George A, Roberts CW, Piccone CM, Howard TA, Davis BR, Ware RE, Genetic Modifiers of White Blood Cell Count, Albuminuria and Glomerular Filtration Rate in Children with Sickle Cell Anemia., PLoS ONE , 11(10), e0164364, 2016 PubMed
4. Kormann R, Jannot AS, Narjoz C, Ribeil JA, Manceau S, Delville M, Joste V, Prié D, Pouchot J, Thervet E, Courbebaisse M, Arlet JB, Roles of APOL1 G1 and G2 variants in sickle cell disease patients: kidney is the main target., Br. J. Haematol. , 2017 PubMed
5. Akinyemi R, Tiwari HK, Arnett DK, Ovbiagele B, Irvin MR, Wahab K, Sarfo F, Srinivasasainagendra V, Adeoye A, Perry RT, Akpalu A, Jenkins C, Arulogun O, Gebregziabher M, Owolabi L, Obiako R, Sanya E, Komolafe M, Fawale M, Adebayo P, Osaigbovo G, Sunmonu T, Olowoyo P, Chukwuonye I, Obiabo Y, Onoja A, Akinyemi J, Ogbole G, Melikam S, Saulson R, Owolabi M, , APOL1, CDKN2A/CDKN2B, and HDAC9 polymorphisms and small vessel ischemic stroke., Acta Neurol. Scand. , 137(1), 133-141, 2018 PubMed