IthaID: 2967



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Variant of Uncertain Significance
Common Name: -22 C>T HGVS Name: HBA2:c.-59C>T
Hb Name: N/A Protein Info: α2 nt -22 C>T

Context nucleotide sequence:
GCCCCCGCGCCCCAAGCATAAAC [C>T] CTGGCGCGCTCGCGGGCCGGCA (Strand: +)

Also known as:

Comments: Found as a heterozygote with normal haematology and biochemical parameters. Point-mutation located at the core promoter region affecting the last nucleotide of the TATA box consensus sequence. Functional studies showed that it can cause up to 54% reduction in the transcriptional activity.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33717
Size: 1 bp
Located at: α2
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Qadah T, Finlayson J, Dennis M, Ghassemifar R, Molecular and cellular analysis of three novel alpha2-globin gene promoter mutations [HBA2: c.-59C>T], [HBA2: c.-81C>A] and [HBA2: c.-91G>A] reveal varying patterns of transcriptional and translational activities., Pathology , 46(1), 46-52, 2014 PubMed
Created on 2016-08-23 15:22:13, Last reviewed on 2017-07-31 12:08:30 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.