IthaID: 3269
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 147 TGA>CGA [Stop>Arg] | HGVS Name: | HBD:c.442T>C |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GCCCTGGCTCACAAGTACCAT [T>C] GAGATCCTGGACTGTTTCCTG (Strand: -)
Also known as:
Comments: The mutation results in the synthesis of a longer polypeptide by 15 amino acids before the new stop codon is reached. Possibly removed by mechanisms for the degradation of aberrant proteins. Detected in a molecular diagnostics laboratory in Italy.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | δ-thalassaemia |
Allele Phenotype: | δ0 |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 64650 |
Size: | 1 bp |
Located at: | δ |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
Ethnic Origin: | Italian, Tunisian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Cassarà F, Vinciguerra M, Cannata M, Marchese G, Passarello C, Leto F, Maggio A, Giambona A, Phenotypic Evaluation of a Novel Nucleotide Substitution (HBD: c.442T>C) on the δ-Globin Gene., Hemoglobin , 41(3), 220-222, 2017 PubMed
- Di Bella C, Pugliatti F, La Rosa MA, Cara S, Capra AP, Rigoli L, A Novel Mutation of the δ-Globin Gene in an Asymptomatic 30-Year-Old Female., Acta Haematol., 139(1), 33-34, 2018 PubMed
- Kasmi C, Amri Y, Hadj-Fredj S, Oueslati S, Dabboussi M, Mahjoub R, Hammami S, Aljane I, Mami FB, Jamoussi H, Messaoud T, Bibi A, Analysis of δ-globin gene alleles in Tunisians: description of three new delta-thalassemia mutations., Mol Biol Rep, 48(8), 5923-5933, 2021 PubMed
Created on 2017-10-02 18:50:57,
Last reviewed on 2021-10-12 12:14:46 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2017-10-02 18:50:57 | The IthaGenes Curation Team | Created |
2 | 2019-05-09 15:01:38 | The IthaGenes Curation Team | Reviewed. DNA info, Ethnic origin, and Reference added. |
3 | 2021-10-12 12:14:46 | The IthaGenes Curation Team | Reviewed. Common name corrected. Origin and reference added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-18 10:10:45