IthaID: 33



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: -22 to +23 (+45 bp duplication) HGVS Name: NG_000007.3:g.70573_70617dup
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
ATCTGACTCCTGAGGA [-/CTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGA] GAAGTCTGCCGTTACT (Strand: -)

Also known as:

Comments: The variant is a duplication of a region of 45 nucleotides from -22 to +23 of the HBB cDNA (coordinates: GRCh38.p13, NC_000011.10). This region includes the start codon encoding two open reading frames. Therefore, transcription from the original initiation codon produces an irrelevant seven-residue peptide, while residual translation from the novel initiation codon results in diminished protein of b-globin.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70573
Size: 45 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Maori
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Blacklock HA, Case J, Chan T, Raizis T, Doocey R, Fellowes A, Royle G, Jackson S, Brennan S, George P, Novel sequence insertion in a Mâori patient with transfusion-dependent beta-thalassaemia., British journal of haematology, 131(3), 400-2, 2005 PubMed
Created on 2010-06-16 16:13:14, Last reviewed on 2021-10-27 08:00:25 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.