IthaID: 359
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | IVS I-1 (-5 bp) GAGGTGAGG>GAGG----- donor | HGVS Name: | HBA2:c.95+2_95+6delTGAGG |
| Hb Name: | N/A | Protein Info: | α2 nts 134-138 deleted |
Context nucleotide sequence:
GTATGGTGCGGAGGCCCTGGAGAGG [-/TGAGG] CTCCCTCCCCTGCTCCGACCCGGGC (Strand: +)
Also known as: α-5nt
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α⁺ |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 33872 |
| Size: | 5 bp |
| Located at: | α2 |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Consensus splice site (mRNA Processing) |
| Ethnic Origin: | Mediterranean, Middle East, Dutch, Moroccan |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Frequencies
Publications / Origin
- Orkin SH, Goff SC, Hechtman RL, Mutation in an intervening sequence splice junction in man., Proceedings of the National Academy of Sciences of the United States of America, 78(8), 5041-5, 1981 PubMed
- Felber BK, Orkin SH, Hamer DH, Abnormal RNA splicing causes one form of alpha thalassemia., Cell , 29(3), 895-902, 1982 PubMed
- Harteveld KL, Heister AJ, Giordano PC, Losekoot M, Bernini LF, Rapid detection of point mutations and polymorphisms of the alpha-globin genes by DGGE and SSCA., Hum. Mutat. , 7(2), 114-22, 1996 PubMed
Created on 2010-06-16 16:13:15,
Last reviewed on 2022-11-10 12:49:31 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2014-05-07 16:25:50 | The IthaGenes Curation Team | Reviewed. Reference added; mutation size corrected. |
| 4 | 2014-10-20 10:15:52 | The IthaGenes Curation Team | Reviewed. |
| 5 | 2014-10-20 10:17:15 | The IthaGenes Curation Team | Reviewed. |
| 6 | 2018-05-16 19:02:08 | The IthaGenes Curation Team | Reviewed. Origin and reference added. |
| 7 | 2022-11-10 12:49:31 | The IthaGenes Curation Team | Reviewed. Links added/updated. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-18 10:10:45