You are here:  
  1. Home
  2. Databases & Tools
  3. IthaGenes

IthaID: 371



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 39 (-ACC) [-Thr] HGVS Name: HBA1:c.118_120del
Hb Name: Hb Taybe Protein Info: α1 39(C4) Thr->0

Context nucleotide sequence:
CAGGATGTTCCTGTCCTTCCCCACC [ACC/-] AAGACCTACTTCCCGCACTTCGACC (Strand: +)

Also known as:

Comments: This deletion results in a structural abnormality that affects the α1β2 contact and the α1β1 interface, producing a highly unstable Hb. Moderate to severe haemolytic anaemia in the homozygote or compound heterozygote state. Normal clinical phenotype in the heterozygote state.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

HbVar dbSNP

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-thalassaemia, α-chain variant
Allele Phenotype:α⁺
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37814
Size: 3 bp
Located at: α1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Arabian, Israeli
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Pobedimskaya DD, Molchanova TP, Streichman S, Huisman TH, Compound heterozygosity for two alpha-globin gene defects, Hb Taybe (alpha 1; 38 or 39 minus Thr) and a poly A mutation (alpha 2; AATAAA-->AATAAG), results in a severe hemolytic anemia., American journal of hematology, 47(3), 198-202, 1994 PubMed
  2. Galacteros F, Girodon E, M'Rad A, Martin J, Goossens M, Jaber L, Cohen IJ, Tamary H, Goshen Y, Zaizov R, Hb Taybe (alpha 38 or 39 THR deleted): an alpha-globin defect, silent in the heterozygous state and producing severe hemolytic anemia in the homozygous., C. R. Acad. Sci. III, Sci. Vie , 317(5), 437-44, 1994 PubMed
  3. Ben-Bassat I, Simjanovska L, Jaber L, Efremov GD, HB Taybe: description of genetics and laboratory findings in an Israeli Arab family., Hemoglobin , 22(2), 161-6, 1998 PubMed
  4. Juul MB, Vestergaard H, Petersen J, Frederiksen H, Thrombosis in Hb Taybe [codons 38/39 (-ACC) (α1)]., Hemoglobin , 36(6), 600-4, 2012 PubMed
  5. Hill QA, Farrar L, Lordan J, Gallienne A, Henderson S, A combination of two novel alpha globin variants Hb Bridlington (HBA1) and Hb Taybe (HBA2) resulting in severe hemolysis, pulmonary hypertension, and death., Hematology , 20(1), 50-2, 2015 PubMed
  6. Koren A, Levin C, Zalman L, Palmor H, Filon D, Chubar E, Resnitzky P, Bennett M, Hb TAYBE: clinical and morphological findings IN 43 patients., Eur. J. Haematol. , 97(2), 137-44, 2016 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2021-04-02 09:46:16 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-12 12:35:12