IthaID: 125


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 30/31 +CGG [+Arg] HGVS Name: HBB:c.93_94insCGG
Hb Name: N/A Protein Info: Arg- inserted between codons 30(B12) and 31(B13) of β

Context nucleotide sequence:
ATTGGTCTATTTTCCCACCCTTAGG [-/CGG] CTGCTGGTGGTCTACCCTTGGACCC (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:β0
Dominant
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70817
Size: 3 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Spanish
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Arjona SN, Eloy-Garcia JM, Gu LH, Smetanina NS, Huisman TH, The dominant beta-thalassaemia in a Spanish family is due to a frameshift that introduces an extra CGG codon ( = arginine) at the 5' end of the second exon., British journal of haematology, 93(4), 841-4, 1996
Created on 2010-06-16 16:13:14, Last reviewed on 2014-06-04 13:19:49 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.