IthaID: 13

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	-86 C>G	HGVS Name:	HBB:c.-136C>G
Hb Name:	N/A	Protein Info:	β nt -86 C>G

Context nucleotide sequence:
AGACCTCACCCTGTGGAGCCACACC [A/C/G] TAGGGTTGGCCAATCTACTCCCAGG (Strand: -)

Also known as:

Comments: The mutation is located at -86 within the proximal CACCC motif in the promoter of the HBB gene. This motif is an erythroid-specific binding site of EKLF, a transcription factor with critical role in erythropoiesis and regulation of haemoglobin switching.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

HbVar	dbSNP
OMIM	LOVD
ClinVar

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	β-thalassaemia
Allele Phenotype:	β+
Associated Phenotypes:	Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	70459
Size:	1 bp
Located at:	β
Specific Location:	Promoter

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	Promoter (Transcription)
Ethnic Origin:	Thai, Lebanese, Syrian
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

Kazazian HH, The thalassemia syndromes: molecular basis and prenatal diagnosis in 1990., Seminars in hematology, 27(3), 209-28, 1990
Thein SL, Winichagoon P, Hesketh C, Best S, Fucharoen S, Wasi P, Weatherall DJ, The molecular basis of beta-thalassemia in Thailand: application to prenatal diagnosis., American journal of human genetics, 47(3), 369-75, 1990
Moassas F, Alabloog A, Murad H, Description of a Rare β-Globin Gene Mutation: -86 (C>G) (HBB: c.-136C>G) Observed in a Syrian Family., Hemoglobin, 42(3), 203-205, 2018

Created on 2010-06-16 16:13:14, Last reviewed on 2019-05-09 13:09:46 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:14	The IthaGenes Curation Team	Created
2	2013-10-15 17:28:32	The IthaGenes Curation Team	Reviewed.
3	2014-04-28 17:51:39	The IthaGenes Curation Team	Reviewed. Added ClinVar link and reference.
4	2019-05-09 13:08:50	The IthaGenes Curation Team	Reviewed. Mutation comment, Ethnic origin and Reference added.
5	2019-05-09 13:09:46	The IthaGenes Curation Team	Reviewed. Comment text edited.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.