IthaID: 156


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 47/48 (+ATCT) HGVS Name: HBB:c.143_146dupATCT
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GGTTCTTTGAGTCCTTTGGGGATCT [-/ATCT] GTCCACTCCTGATGCTGTTATGGGC (Strand: -)

Also known as:

Comments: Found in one Punjabi Indian patient [PMID: 8199027]. Found in members of a Sikh family from United Arab Emirates. The proband was compound heterozygote for this deletion and a β0 allele (HBB:c.174_175insC), whereas his father and sisten had beta-thalassaemia trait [PMID: 7558874].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70867
Size: 4 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Asian Indian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Garewal G, Fearon CW, Warren TC, Marwaha N, Marwaha RK, Mahadik C, Kazazian HH, The molecular basis of beta thalassaemia in Punjabi and Maharashtran Indians includes a multilocus aetiology involving triplicated alpha-globin loci., British journal of haematology, 86(2), 372-6, 1994
  2. el-Kalla S, Mathews AR, A novel frameshift mutation causing beta-thalassemia in a Sikh., Hemoglobin, 19(3), 183-9, 1995
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-12 12:50:29 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.