IthaID: 1571


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: -175 T>C HGVS Name: HBG1:c.-228T>C
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CTTCCCCACACTATCTCAATGCAAA [C/T] ATCTGTCTGAAACGGTCCCTGGCTA (Strand: -)

Also known as: Black non-deletional HPFH

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: HPFH
Hemoglobinopathy Subgroup: HPFH
Allele Phenotype:HPFH
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 47584
Size: 1 bp
Located at:
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: African
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Stoming TA, Stoming GS, Lanclos KD, Fei YJ, Altay C, Kutlar F, Huisman TH, An A gamma type of nondeletional hereditary persistence of fetal hemoglobin with a T----C mutation at position -175 to the cap site of the A gamma globin gene., Blood, 73(1), 329-33, 1989
  2. Coleman MB, Adams JG, Steinberg MH, Plonczynski MW, Harrell AH, Castro O, Winter WP, G gamma A gamma (beta+) hereditary persistence of fetal hemoglobin: the G gamma -158 C-->T mutation in cis to the -175 T-->C mutation of the A gamma-globin gene results in increased G gamma-globin synthesis., American journal of hematology, 42(2), 186-90, 1993
  3. Akinbami AO, Campbell AD, Han ZJ, Luo HY, Chui DH, Steinberg MH, Hereditary Persistence of Fetal Hemoglobin Caused by Single Nucleotide Promoter Mutations in Sickle Cell Trait and Hb SC Disease., Hemoglobin , 40(1), 64-5, 2016
Created on 2010-06-16 16:13:17, Last reviewed on 2016-08-26 09:05:02 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.