IthaID: 2073

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs10184550 HGVS Name: NG_011968.1:g.56340C>T

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CAACTCAAGACTATCAGAATGATAT [A/G] AATATTTGTATAGATACTTATCAAA (Strand: +)

Comments: SNP was associated with variation in HbF levels and F-cell numbers in African Americans with sickle cell disease (n=255).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
F-cell numbers

Location

Chromosome: 2
Locus: NG_011968.1
Locus Location: 56340
Size: 1 bp
Located at: BCL11A
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Sedgewick AE, Timofeev N, Sebastiani P, So JC, Ma ES, Chan LC, Fucharoen G, Fucharoen S, Barbosa CG, Vardarajan BN, Farrer LA, Baldwin CT, Steinberg MH, Chui DH, BCL11A is a major HbF quantitative trait locus in three different populations with beta-hemoglobinopathies., Blood Cells Mol. Dis. , 41(3), 255-8, 2008
Created on 2013-06-28 12:24:09, Last reviewed on 2016-05-17 17:52:49 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.