IthaID: 2081
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 328 (CGC>CTC) | HGVS Name: | NG_013087.1:g.7213G>T |
Context nucleotide sequence:
TTCGCGCGCTCGGACGAGCTGACCC [G/T] CCACTACCGGAAACACACGGGGCAG (Strand: -)
Also known as:
Comments: Protein change: R328L, Dominant Lu (a-b-) Phenotype
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | Increased expression for Aγ or Gγ |
Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
Chromosome: | 19 |
---|---|
Locus: | NG_013087.1 |
Locus Location: | 7213 |
Size: | 1 bp |
Located at: | KLF1 |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Slovakian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Singleton BK, Burton NM, Green C, Brady RL, Anstee DJ, Mutations in EKLF/KLF1 form the molecular basis of the rare blood group In(Lu) phenotype., Blood , 112(5), 2081-8, 2008
- Singleton BK, Lau W, Fairweather VS, Burton NM, Wilson MC, Parsons SF, Richardson BM, Trakarnsanga K, Brady RL, Anstee DJ, Frayne J, Mutations in the second zinc finger of human EKLF reduce promoter affinity but give rise to benign and disease phenotypes., Blood , 118(11), 3137-45, 2011
- Gallienne AE, Dréau HM, Schuh A, Old JM, Henderson S, Ten novel mutations in the erythroid transcription factor KLF1 gene associated with increased fetal hemoglobin levels in adults., Haematologica , 97(3), 340-3, 2012
Created on 2013-06-28 13:07:50,
Last reviewed on 2014-03-18 12:01:12 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2013-06-28 13:07:50 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
3 | 2014-03-18 12:01:12 | The IthaGenes Curation Team | Reviewed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-30 12:06:09