
IthaID: 2103
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs6904897 | HGVS Name: | NC_000006.12:g.135061842T>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CAGGCTTGCCAAATATACCTTGTTA [G/T] TGTATGCACAACcaaaagaaataca (Strand: +)
Comments: SNP associated with variation in F-cell numbers in healthy Northern Europeans (TwinUK cohort). It exhibited strong effect on the severity of β-thalassaemia phenotype in Sardinian subjects.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | F-cell numbers |
Location
| Chromosome: | 6 |
|---|---|
| Locus: | NT_025741.15 |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | HBS1L-MYB |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Sardinian, Northern European |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Menzel S, Garner C, Gut I, Matsuda F, Yamaguchi M, Heath S, Foglio M, Zelenika D, Boland A, Rooks H, Best S, Spector TD, Farrall M, Lathrop M, Thein SL, A QTL influencing F cell production maps to a gene encoding a zinc-finger protein on chromosome 2p15., Nat. Genet. , 39(10), 1197-9, 2007
- Danjou F, Anni F, Perseu L, Satta S, Dessì C, Lai ME, Fortina P, Devoto M, Galanello R, Genetic modifiers of β-thalassemia and clinical severity as assessed by age at first transfusion., Haematologica , 97(7), 989-93, 2012
Created on 2013-09-13 14:34:30,
Last reviewed on 2018-11-20 17:42:33 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.