IthaID: 211
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | IVS II-654 C>T | HGVS Name: | HBB:c.316-197C>T |
| Hb Name: | N/A | Protein Info: | β nt 1149 C>T |
Context nucleotide sequence:
AACAGTGATAATTTCTGGGTTAAGG [C/T] AATAGCAATATCTCTGCATATAAAT (Strand: -)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 / β+ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71693 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Cryptic splice site (mRNA Processing) |
| Ethnic Origin: | Chinese, SE Asian, Japanese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Cheng TC, Orkin SH, Antonarakis SE, Potter MJ, Sexton JP, Markham AF, Giardina PJ, Li A, Kazazian HH, beta-Thalassemia in Chinese: use of in vivo RNA analysis and oligonucleotide hybridization in systematic characterization of molecular defects., Proceedings of the National Academy of Sciences of the United States of America, 81(9), 2821-5, 1984
- Takihara Y, Matsunaga E, Nakamura T, Lin S, Lee H, Fukumaki Y, Takagi Y, One base substitution in IVS-2 causes a beta +-thalassemia phenotype in a Chinese patient., Biochemical and biophysical research communications, 121(1), 324-30, 1984
Created on 2010-06-16 16:13:15,
Last reviewed on 2014-04-24 16:08:23 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.