
IthaID: 2111
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs6934903 | HGVS Name: | NC_000006.12:g.135130426T>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGCCTGCATAAGTGTCGAATCTCTA [A/T] CAGTGGTACCATTAACCTCTTAACA (Strand: +)
Comments: SNP associated with HbF levels in β-thalassaemia patients from China.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
Chromosome: | 6 |
---|---|
Locus: | NT_025741.15 |
Locus Location: | N/A |
Size: | 1 bp |
Located at: | HBS1L-MYB |
Specific Location: | N/A |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Chinese |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- So CC, Song YQ, Tsang ST, Tang LF, Chan AY, Ma ES, Chan LC, The HBS1L-MYB intergenic region on chromosome 6q23 is a quantitative trait locus controlling fetal haemoglobin level in carriers of beta-thalassaemia., J. Med. Genet. , 45(11), 745-51, 2008
- Yi S, Lai Y, Zuo Y, Chen Y, Qin H, Wei Y, Yang Q, Lin L, Luo J, Fan X, Zheng C, Common genetic polymorphisms at three loci affect HbF levels in β-thalassemia patients from Southern China., Blood Cells Mol. Dis. , 62(0), 22-23, 2016
Created on 2013-09-17 12:56:40,
Last reviewed on 2018-11-20 19:11:38 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.