IthaID: 2112

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs114398597 HGVS Name: NC_000006.12:g.135107536A>G

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TTTCTCCTCAAAATCTTCCTTCGCT [A/G] CTAAAAGGTGTAGGCACATAGTTTC (Strand: +)

Comments: SNP associated with HbF levels in the Cooperative Study of Sickle Cell Disease (CSSCD) (n=1032).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 6
Locus: NT_025741.15
Locus Location: N/A
Size: 1 bp
Located at: HBS1L-MYB
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Galarneau G, Palmer CD, Sankaran VG, Orkin SH, Hirschhorn JN, Lettre G, Fine-mapping at three loci known to affect fetal hemoglobin levels explains additional genetic variation., Nat. Genet. , 42(12), 1049-51, 2010
Created on 2013-09-17 12:59:36, Last reviewed on 2018-11-20 19:12:45 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.