
IthaID: 2114
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | IVS XII-9251 G>A | HGVS Name: | NG_007563.1:g.115072G>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TACCAATGTATTGTTCTGTTTAAAAT [A/G] TGGAAACCTGAGGAAATGAACAAAG (Strand: +)
Comments: Moderately strong association with F-cell levels
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | Increased expression for Aγ or Gγ |
| Associated Phenotypes: | F-cell numbers |
Location
| Chromosome: | X |
|---|---|
| Locus: | NG_007563.1 |
| Locus Location: | 115072 |
| Size: | 1 bp |
| Located at: | PHEX |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Africans |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Bhatnagar P, Purvis S, Barron-Casella E, DeBaun MR, Casella JF, Arking DE, Keefer JR, Genome-wide association study identifies genetic variants influencing F-cell levels in sickle-cell patients., J. Hum. Genet. , 56(4), 316-23, 2011
Created on 2013-09-18 16:37:53,
Last reviewed on 2019-07-03 11:05:03 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.