IthaID: 2131

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: CD 270 (TCG>TAG) HGVS Name: NG_013087.1:g.6783C>A

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GCGCCATCCAAGCGAGGCCGACGTT [C/A] GTGGGCGCGCAAGAGGCAGGCAGCG (Strand: -)

Comments: Protein change: S270X. KLF1 haploinsufficiency due to S270X non-sense mutation is associated with significant age-related variation of HbF levels. In a Sardinia family, high levels of HbF were present only in compound heterozygotes for the S270X nonsense and K332Q missense mutations. Associated with borderline HbA2.

External Links

No available links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):Increased expression for Aγ or Gγ
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 19
Locus: NG_013087.1
Locus Location: 6783
Size: 1 bp
Located at: KLF1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Nonsense codon (Translation), Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Sardinians
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Satta S, Perseu L, Moi P, Asunis I, Cabriolu A, Maccioni L, Demartis FR, Manunza L, Cao A, Galanello R, Compound heterozygosity for KLF1 mutations associated with remarkable increase of fetal hemoglobin and red cell protoporphyrin., Haematologica , 96(5), 767-70, 2011
  2. Perseu L, Satta S, Moi P, Demartis FR, Manunza L, Sollaino MC, Barella S, Cao A, Galanello R, KLF1 gene mutations cause borderline HbA(2)., Blood , 118(16), 4454-8, 2011
  3. Satta S, Perseu L, Maccioni L, Giagu N, Galanello R, Delayed fetal hemoglobin switching in subjects with KLF1 gene mutation., Blood Cells Mol. Dis. , 48(1), 22-4, 2012
Created on 2013-09-24 16:45:55, Last reviewed on 2016-09-12 17:14:09 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.