IthaID: 2139

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2693430 HGVS Name: NG_011993.1:g.311720T>C

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TGGGAACGTCCTCCACACCCTTCCC [A/G] CTTTCCAGTATTTAAAGCGTGCTTC (Strand: +)

Comments: SNP associated with the HbF response to treatment with hydroxyurea in individuals with sickle cell disease (n=137) acquired from the Multicenter Study of Hydroxyurea in Sickle Cell Anemia (MSH).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F response to hydroxyurea

Location

Chromosome: 8
Locus: NG_011993.1
Locus Location: 311720
Size: 1 bp
Located at: TOX
Specific Location: Intron 7

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Ma Q, Wyszynski DF, Farrell JJ, Kutlar A, Farrer LA, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: genetic determinants of response to hydroxyurea., Pharmacogenomics J. , 7(6), 386-94, 2007
Created on 2013-09-27 10:21:29, Last reviewed on 2016-05-12 12:44:56 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.