IthaID: 2183


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Variant of Uncertain Significance
Common Name: IVS II-781 C>G HGVS Name: HBB:c.316-70C>G
Hb Name: N/A Protein Info: β nt 1276 C>G

Context nucleotide sequence:
CTTTTATTTTATGGTTGGGATAAGG [C/G] TGGATTATTCTGAGTCCAAGCTAGG (Strand: -)

Also known as:

Comments: In the first report described as a β+ variant in a case with heterozygosity with the Hb A2’, HBD:c.49G>C [IthaID:1356], presented with elevated HbA2 4.4% but normal haematological indices. Furthermore, found in coinheritance with other α-, β- or δ-globin gene defects, shown no influence or change of this sequence variant on the expected hematological and clinical indices as simple carrier. The HBB:c.316-70C>G, was associated with Hb A2’ in most cases, suggesting that these two mutations are in linkage.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:Unclear
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71820
Size: 1 bp
Located at: β
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Henderson SJ, Timbs AT, McCarthy J, Gallienne AE, Proven M, Rugless MJ, Lopez H, Eglinton J, Dziedzic D, Beardsall M, Khalil MS, Old JM, Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations., Hemoglobin , 40(2), 75-84, 2016
  2. Vinciguerra M, Passarello C, Leto F, Crivello A, Fustaneo M, Cassarà F, Cannata M, Maggio A, Giambona A, Coinheritance of a Rare Nucleotide Substitution on the β-Globin Gene and Other Known Mutations in the Globin Clusters: Management in Genetic Counseling., Hemoglobin, 40(4), 231-5, 2016
  3. Grimholt RM, Harteveld CL, Arkesteijn SGJ, Fjeld B, Klingenberg O, Characterization of Two Deep Intronic Variants on the β-Globin Gene with Inconsistent Interpretations of Clinical Significance., Hemoglobin, 42(2), 126-128, 2018
Created on 2013-09-30 16:20:59, Last reviewed on 2022-02-17 21:40:35 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.