IthaID: 2277

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: CD 332 (AAA>CAA) HGVS Name: NG_013087.1:g.7224A>C

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GGACGAGCTGACCCGCCACTACCGG [A/C] AACACACGGGGCAGCGCCCCTTCCG (Strand: -)

Comments: Protein change: K332Q. In a Sardinia family, high levels of HbF were present only in compound heterozygotes for the S270X nonsense and K332Q missense mutations.

External Links

No available links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 19
Locus: NG_013087.1
Locus Location: 7224
Size: 1 bp
Located at: KLF1
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Sardinians
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Satta S, Perseu L, Moi P, Asunis I, Cabriolu A, Maccioni L, Demartis FR, Manunza L, Cao A, Galanello R, Compound heterozygosity for KLF1 mutations associated with remarkable increase of fetal hemoglobin and red cell protoporphyrin., Haematologica , 96(5), 767-70, 2011
Created on 2013-10-08 17:39:58, Last reviewed on 2014-03-20 10:43:56 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.