IthaID: 2284
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 141 CTG>GGG | HGVS Name: | HBB:c.424C>G |
Hb Name: | Hb Aurillac | Protein Info: | β 141(H19) Leu>Val |
Context nucleotide sequence:
AGTGGTGGCTGGTGTGGCTAATGCC [C/G] TGGCCCACAAGTATCACTAAGCTCG (Strand: -)
Also known as:
Comments: This variant has been previously described in a Japanese woman in combination with a second mutation in exon 3 of the same β-globin gene. The variant associating the two mutations was named Hb Kochi [β141(H19)Leu>Val (c.424C>G) ; 144>146(HC1)Lys-Tyr-His->0 (c.433A>T)]. In the double variant hemoglobin, the β141(H19) Leu>Val mutant was initially thought to have no contribution in the Hb affinity disorder, a conclusion which is not supported by the description of this variant.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Hemoglobinopathy Group: | Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | β-chain variant |
Allele Phenotype: | N/A |
Stability: | N/A |
Oxygen Affinity: | Increased Oxygen Affinity |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 71998 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
Ethnic Origin: | Caucasian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Boursier G, Trouillier S, Blaizot MG, Igual H, Schved JF, Martinez PA, A New High Affinity Variant Hb Aurillac (β141Leu→Val)., Hemoglobin , 2013
Created on 2013-10-09 13:33:47,
Last reviewed on 2013-10-15 17:00:14 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2013-10-09 13:33:47 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-03-28 09:17:36