
IthaID: 2289
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | IVS I-146 (G>A) | HGVS Name: | NT_010393.16:g.31479430G>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGGGAGGAAGTGGGTTGGGGGAAATACCCAGTGAGGAGGGAAACAGATAT [G/A] TAAATTCTACCCTTTTCTCTACCCAGGCAGATGGCTCTTCTTAAGGCCAATAAGGATCTC (Strand: +)
Comments: This SNP in intron 1 of AHSP affects the Oct-1 transcription factor binding site, which is required for optimal AHSP promoter activity. The A allele is predicted to impair Oct-1 binding and thus reduce ASHP mRNA expression. (PMID 16186125)
External Links
Phenotype
Allele Phenotype (Cis): | Decreased expression for AHSP |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Anaemia [HP:0001903] |
Location
Chromosome: | 16 |
---|---|
Locus: | NT_010393.16 |
Locus Location: | 31479430 |
Size: | 1 bp |
Located at: | AHSP |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Promoter (Transcription) |
Ethnic Origin: | Afro-Caribbean, Indian, Brasilian, Mediterranean, Papua New Guinean, Melanesian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Gallagher PG, Liem RI, Wong E, Weiss MJ, Bodine DM, GATA-1 and Oct-1 are required for expression of the human alpha-hemoglobin-stabilizing protein gene., J. Biol. Chem. , 280(47), 39016-23, 2005
Created on 2013-10-16 17:04:31,
Last reviewed on 2019-07-04 12:01:21 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.