
IthaID: 2290
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 77 CTG>CTT | HGVS Name: | NT_010393.16:g.31479934G>T |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CAAGAGCGAGACAAGGCTCTGCAGGAGCTTCGGCAAGAGCTGAACACTCT [G/T] GCCAACCCTTTCCTGGCCAAGTACAGGGACTTCCTGAAGTCTCATGAGCT (Strand: +)
Comments: Apparently neutral polymorphism in exon 3 of AHSP (alpha-hemoglobin stabilizing protein)
External Links
Phenotype
| Allele Phenotype: | Neutral |
|---|---|
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NT_010393.16 |
| Locus Location: | 31479934 |
| Size: | 1 bp |
| Located at: | AHSP |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Afro-Caribbean, Indian, Brasilian, Mediterranean, Papua New Guinean, Melanesian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- dos Santos CO, Zhou S, Secolin R, Wang X, Cunha AF, Higgs DR, Kwiatkowski JL, Thein SL, Gallagher PG, Costa FF, Weiss MJ, Population analysis of the alpha hemoglobin stabilizing protein (AHSP) gene identifies sequence variants that alter expression and function., Am. J. Hematol. , 83(2), 103-8, 2008
Created on 2013-10-16 18:01:05,
Last reviewed on 2020-09-28 16:46:33 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.