IthaID: 242
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 120 -A [156 aa] | HGVS Name: | HBB:c.363delA |
Hb Name: | Hb Filottrano | Protein Info: | β 120 (-A); modified C-terminal sequence |
Context nucleotide sequence:
GCTGGCCCATCACTTTGGCAA [-/A] GAATTCACCCCACCAGTG (Strand: -)
Also known as: CD 120 AAA>AA-
Comments: Single nucleotide deletion (-A) resulting in a frameshift and the elongation of the β-globin chain to 156 amino acids. Found as a compound heterozygote with Hb C in a patient of undisclosed ethnicity, presenting with severe anaemia. Also found in a heterozygous state in an Italian proband presenting with a β-thalassaemia intermedia phenotype. Reported in literature as HBB:c.361delA, which does not follow the HGVS Sequence Variant Nomeclature recommendations.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
Allele Phenotype: | Dominant |
Stability: | N/A |
Oxygen Affinity: | N/A |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 71937 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Italian |
Molecular mechanism: | N/A |
Inheritance: | Dominant |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Frischknecht H, Dutly F, Walker L, Nakamura-Garrett LM, Eng B, Waye JS, Three new beta-thalassemia mutations with varying degrees of severity., Hemoglobin, 33(3), 220-5, 2009
- Amato A, Cappabianca MP, Perri M, Zaghis I, Mastropietro F, Ponzini D, Di Biagio P, Piscitelli R, Hb Filottrano [codon 120 (-A)]: a novel frameshift mutation in exon 3 of the β-globin gene causing dominantly inherited β-thalassemia intermedia., Hemoglobin , 36(5), 480-4, 2012
Created on 2010-06-16 16:13:15,
Last reviewed on 2019-11-06 11:56:50 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
3 | 2014-06-03 12:25:44 | The IthaGenes Curation Team | Reviewed. Hb variant name, additional reference and HbVar link added. |
4 | 2019-11-06 11:55:32 | The IthaGenes Curation Team | Reviewed. HGVS name and Location corrected. Context sequence and Comment added. |
5 | 2019-11-06 11:56:50 | The IthaGenes Curation Team | Reviewed. Synonym name added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-03-28 09:17:36