IthaID: 247


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 124 (-A) >156aa HGVS Name: HBB:c.375delA
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
ATCACTTTGGCAAAGAATTCACCCC [-/A] CCAGTGCAGGCTGCCTATCAGAAAG (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Dominant
Stability: Hyperunstable
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71949
Size: 1 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Russian
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Cürük MA, Molchanova TP, Postnikov YuV , Pobedimskaya DD, Liang R, Baysal E, Kolodey S, Smetanina NS, Tokarev YuN , Rumyantsev AG, Beta-thalassemia alleles and unstable hemoglobin types among Russian pediatric patients., American journal of hematology, 46(4), 329-32, 1994
  2. Henderson SJ, Timbs AT, McCarthy J, Gallienne AE, Proven M, Rugless MJ, Lopez H, Eglinton J, Dziedzic D, Beardsall M, Khalil MS, Old JM, Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations., Hemoglobin , 40(2), 75-84, 2016
Created on 2010-06-16 16:13:15, Last reviewed on 2016-08-31 17:19:02 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.