IthaID: 2482
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 137 -GTG [-Val] | HGVS Name: | HBD:c.412_414delGTG |
Hb Name: | Hb Lincoln Park | Protein Info: | δ 137(H15) Val->0 |
Context nucleotide sequence:
TGCCTATCAGAAGGTGGTGGCTGGT [-/GTG] GCTAATGCCCTGGCTCACAAGTACC (Strand: -)
Also known as: Hb Anti-Lepore Lincoln Park
Comments: A δβ fusion (anti-Lepore) variant with an amino acid deletion in the δ chain-derived segment. Hb Lincoln Park is identical to HbP-Nilotic but is associated with reticulocytosis. It contains a deletion of
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Hemoglobinopathy Group: | Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | δ-chain variant |
Allele Phenotype: | δβ fusion |
Stability: | N/A |
Oxygen Affinity: | N/A |
Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 64620 |
Size: | 3 bp |
Located at: | δ |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Mexican |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Honig GR, Shamsuddin M, Mason RG, Vida LN, Hemoglobin Lincoln Park: a betadelta fusion (anti-Lepore) variant with an amino acid deletion in the delta chain-derived segment., Proc. Natl. Acad. Sci. U.S.A. , 75(3), 1475-9, 1978
- Honig GR, Mason RG, Tremaine LM, Vida LN, Unbalanced globin chain synthesis by Hb Lincoln Park (anti-Lepore) reticulocytes., Am. J. Hematol. , 5(4), 335-40, 1978
Created on 2014-06-04 13:38:35,
Last reviewed on 2018-04-17 09:20:37 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2014-06-04 13:38:35 | The IthaGenes Curation Team | Created |
2 | 2015-12-07 16:55:27 | The IthaGenes Curation Team | Reviewed. |
3 | 2018-04-17 09:20:37 | The IthaGenes Curation Team | Reviewed. Location corrected |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-03-28 09:17:36