IthaID: 2585

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs211239 HGVS Name: NG_011485.1:g.10619A>G

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TTTAAAATTTTTTCTTGGACTTGAC [C/T] GTAACCTTCAAAAAACAATGTGTTC (Strand: -)

Comments: SNP associated with avascular necrosis/osteonecrosis in the Cooperative Study of Sickle Cell Disease (CSSCD) (442 cases; 455 controls) [PMID: 15784727]. The association was not replicated in an independent sample of sickle cell patients of West African or African Caribbean descent (39 cases; 205 controls) [PMID: 19093115]. SNP associated with priapism in the CSSCD (148 cases; 529 controls) [PMID: 15638863], but the association was not replicated in an independent sample of sickle cell patients acquired from outpatient clinics at the Duke University Medical Center, the University of North Carolina Chapel Hill and the Emory University (n=199) [PMID: 17408468].

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Osteonecrosis/Avascular necrosis [HP:0010885] [OMIM:608805]
Priapism [HP:0200023] [OMIM:176620]

Location

Chromosome: 13
Locus: NG_011485.1
Locus Location: 10619
Size: 1 bp
Located at: KL
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Baldwin C, Nolan VG, Wyszynski DF, Ma QL, Sebastiani P, Embury SH, Bisbee A, Farrell J, Farrer L, Steinberg MH, Association of klotho, bone morphogenic protein 6, and annexin A2 polymorphisms with sickle cell osteonecrosis., Blood , 106(1), 372-5, 2005
  2. Nolan VG, Baldwin C, Ma Q, Wyszynski DF, Amirault Y, Farrell JJ, Bisbee A, Embury SH, Farrer LA, Steinberg MH, Association of single nucleotide polymorphisms in klotho with priapism in sickle cell anaemia., Br. J. Haematol. , 128(2), 266-72, 2005
  3. Elliott L, Ashley-Koch AE, De Castro L, Jonassaint J, Price J, Ataga KI, Levesque MC, Brice Weinberg J, Eckman JR, Orringer EP, Vance JM, Telen MJ, Genetic polymorphisms associated with priapism in sickle cell disease., Br. J. Haematol. , 137(3), 262-7, 2007
  4. Ulug P, Vasavda N, Awogbade M, Cunningham J, Menzel S, Thein SL, Association of sickle avascular necrosis with bone morphogenic protein 6., Ann. Hematol. , 88(8), 803-5, 2009
  5. Lettre G, The search for genetic modifiers of disease severity in the β-hemoglobinopathies., Cold Spring Harb Perspect Med , 2(10), , 2012
Created on 2016-05-09 12:16:06, Last reviewed on 2016-05-16 10:44:07 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.