
IthaID: 2606
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs284157 | HGVS Name: | NG_027757.1:g.104640G>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ATCTGTTCCCAAATGCTTTGTCTGC [A/G] TTCTGTCGAGTTTTGGAGCTGGCCC (Strand: -)
Comments: SNP associated with osteonecrosis in the Cooperative Study of Sickle Cell Disease (CSSCD) (442 cases; 455 controls). Associated with acute chest syndrome in individuals with sickle cell disease.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Acute chest syndrome Osteonecrosis/Avascular necrosis [HP:0010885] [OMIM:608805] |
Location
| Chromosome: | 1 |
|---|---|
| Locus: | NG_027757.1 |
| Locus Location: | 104640 |
| Size: | 1 bp |
| Located at: | TGFBR3 |
| Specific Location: | Intron 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Lanson Y, Reignoux J, Jobard P, Vandooren M, Rouleau P, Soret JY, [Osteogenic sarcoma of the kidney. Apropos of a case. Review of the literature]., J Urol Nephrol (Paris) , 84(10), 827-34, 1978
Created on 2016-05-09 17:44:10,
Last reviewed on 2022-09-13 15:05:23 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.