
IthaID: 2648
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1801253 | HGVS Name: | NG_012187.1:g.6251G>C |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCCCGACTTCCGCAAGGCCTTCCAG [C/G] GACTGCTCTGCTGCGCGCGCAGGGC (Strand: +)
Comments: SNP associated with pulmonary hypertension risk in individuals with sickle cell disease (aged 18 years and older) acquired from outpatient clinics at the Duke University Medical Center and the University of North Carolina Chapel Hill (n=581).
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Pulmonary arterial hypertension [HP:0002092] [OMIM:265400] |
Location
| Chromosome: | 10 |
|---|---|
| Locus: | NG_012187.1 |
| Locus Location: | 6251 |
| Size: | 1 bp |
| Located at: | ADRB1 |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Ashley-Koch AE, Elliott L, Kail ME, De Castro LM, Jonassaint J, Jackson TL, Price J, Ataga KI, Levesque MC, Weinberg JB, Orringer EP, Collins A, Vance JM, Telen MJ, Identification of genetic polymorphisms associated with risk for pulmonary hypertension in sickle cell disease., Blood , 111(12), 5721-6, 2008
Created on 2016-05-10 17:36:23,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.