IthaID: 265


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 141 (-C) >156aa HGVS Name: HBB:c.424delC
Hb Name: Hb Florida Protein Info: β 141 (-C); modified C-terminal sequence: (141)Trp-Pro-Thr-Ser-Ile-Thr-Lys-Leu-Ala-Phe- Leu-Leu-Ser-Asn-Phe-(156)Tyr-COOH

Context nucleotide sequence:
AGTGGTGGCTGGTGTGGCTAATGCC [C/-] TGGCCCACAAGTATCACTAAGCTCG (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Thalassaemia dominant
Dominant
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71998
Size: 1 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Argentinian
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Weinstein BI, Erramouspe B, Albuquerque DM, Oliveira DM, Kimura EM, Costa FF, Sonati MF, Hb Florida: a novel elongated C-terminal beta-globin variant causing dominant beta-thalassemia phenotype., American journal of hematology, 81(5), 358-60, 2006
Created on 2010-06-16 16:13:15, Last reviewed on 2023-08-04 12:47:18 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.