
IthaID: 2652
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs489347 | HGVS Name: | NG_011828.1:g.83070C>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ACAGCAAAGAGACAGCAGTGACTTA [C/G] GACTGGAGAAGCTTCTACACATTGA (Strand: -)
Comments: SNP associated with risk of stroke in the Cooperative Study of Sickle Cell Disease (CSSCD) (92 cases; 1306 controls). The association was replicated in an independent sample of pediatric SCD patients acquired from the Stroke With Transfusion Changing to Hydrxyurea (SWiTCH) trial (130 cases; 103 controls enrolled from the HUSTLE study). SNP (allele C) associated with an increased risk of acute cerebral ischemia (n=395) and of high-risk transcranial Doppler (n=338) in a pediatric Brazilian cohort with SCD.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Stroke [HP:0001297] [OMIM:601367] |
Location
| Chromosome: | 9 |
|---|---|
| Locus: | NG_011828.1 |
| Locus Location: | 83070 |
| Size: | 1 bp |
| Located at: | TEK |
| Specific Location: | Intron |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American | Brazilian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Flanagan JM, Frohlich DM, Howard TA, Schultz WH, Driscoll C, Nagasubramanian R, Mortier NA, Kimble AC, Aygun B, Adams RJ, Helms RW, Ware RE, Genetic predictors for stroke in children with sickle cell anemia., Blood , 117(24), 6681-4, 2011
- Belisário AR, Sales RR, Toledo NE, Muniz MB, Velloso-Rodrigues C, Silva CM, Viana MB, Reticulocyte count is the most important predictor of acute cerebral ischemia and high-risk transcranial Doppler in a newborn cohort of 395 children with sickle cell anemia., Ann. Hematol. , 95(11), 1869-80, 2016