IthaID: 267
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | 3'UTR +6 C>G | HGVS Name: | HBB:c.*6C>G |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
TGGCCCACAAGTATCACTAAGCTCG [C/G] TTTCTTGCTGTCCAATTTCTATTAA (Strand: -)
Also known as: Terminal CD +6 C>G, CAP +1480, β nt 1480 C>G
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β+ β++ (silent) |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 72024 |
Size: | 1 bp |
Located at: | β |
Specific Location: | 3'UTR |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Other 3'UTR site (mRNA Processing) |
Ethnic Origin: | Greek |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Jankovic L, Dimovski AJ, Kollia P, Karageorga M, Loukopoulos D, Huisman TH, A C----G mutation at nt position 6 3' to the terminating codon may be the cause of a silent beta-thalassemia., International journal of hematology, 54(4), 289-93, 1991
- Maragoudaki E, Vrettou C, Kanavakis E, Traeger-Synodinos J, Metaxotou-Mavrommati A, Kattamis C, Molecular, haematological and clinical studies of a silent beta-gene C-->G mutation at 6 bp 3' to the termination codon (+1480 C-->G) in twelve Greek families., British journal of haematology, 103(1), 45-51, 1998
Created on 2010-06-16 16:13:15,
Last reviewed on 2022-05-17 16:07:58 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
3 | 2014-04-08 15:53:23 | The IthaGenes Curation Team | Reviewed. |
4 | 2014-10-09 16:20:50 | The IthaGenes Curation Team | Reviewed. Common name corrected |
5 | 2014-10-09 16:21:18 | The IthaGenes Curation Team | Reviewed. |
6 | 2014-10-09 16:23:22 | The IthaGenes Curation Team | Reviewed. HGVS name corrected. |
7 | 2022-05-17 16:07:58 | The IthaGenes Curation Team | Reviewed. Common name corrected. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-24 11:43:02