IthaID: 2679
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs17728960 | HGVS Name: | NC_000020.11:g.51513177T>C |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AAGTTTTTAAATCATATATTGGATC [C/T] TCAAAGTTACAGGCACTTGGGCCAC (Strand: +)
Comments: SNP associated with acute chest syndrome in the Cooperative Study of Sickle Cell Disease (CSSCD) (n=1901). Follow-up validation studies replicated the association in individuals with sickle cell disease (SCD) acquired from the Georgia Health Sciences University (GHSU) Sickle Cell Center (n=318) but not in an independent SCD cohort acquired from the Duke University (n=449).
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Acute chest syndrome |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Galarneau G, Coady S, Garrett ME, Jeffries N, Puggal M, Paltoo D, Soldano K, Guasch A, Ashley-Koch AE, Telen MJ, Kutlar A, Lettre G, Papanicolaou GJ, Gene-centric association study of acute chest syndrome and painful crisis in sickle cell disease patients., Blood , 122(3), 434-42, 2013
Created on 2016-05-11 17:16:32,
Last reviewed on 2016-05-11 17:23:08 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.