
IthaID: 2685
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs5014202 | HGVS Name: | NG_012244.1:g.858T>C |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCTGCTACTTTCACCATCTCATCCC [C/T] TGTGGAGCTTACATCCCAAAGGTAG (Strand: +)
Comments: SNP associated with bacteraemia in the Cooperative Study of Sickle Cell Disease (CSSCD) (145 cases; 1248 controls).
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Bacteremia [HP:0031864] |
Location
| Chromosome: | 15 |
|---|---|
| Locus: | NG_012244.1 |
| Locus Location: | 858 |
| Size: | 1 bp |
| Located at: | SMAD6 |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Adewoye AH, Nolan VG, Ma Q, Baldwin C, Wyszynski DF, Farrell JJ, Farrer LA, Steinberg MH, Association of polymorphisms of IGF1R and genes in the transforming growth factor- beta /bone morphogenetic protein pathway with bacteremia in sickle cell anemia., Clin. Infect. Dis. , 43(5), 593-8, 2006
Created on 2016-05-11 18:07:04,
Last reviewed on 2019-07-03 14:35:37 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.