
IthaID: 2787
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs4808793 | HGVS Name: | NC_000019.10:g.18383027G>C |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ACATGCAGACACCCACACACACCCA [C/G] TATCTGCCGGACAGGGCAGCCCTTC (Strand: +)
Comments: SNP associated with increased GDF15 levels, which had a suppressive effect on serum hepcidin levels in β-thalassaemia patients from India (n=134).
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Abnormal hepcidin level [HP:0031875] |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Indian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Athiyarath R, George B, Mathews V, Srivastava A, Edison ES, Association of growth differentiation factor 15 (GDF15) polymorphisms with serum GDF15 and ferritin levels in β-thalassemia., Ann. Hematol. , 93(12), 2093-5, 2014
Created on 2016-05-16 15:18:15,
Last reviewed on 2016-09-12 12:48:52 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.