IthaID: 2802
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs2855126 | HGVS Name: | NG_000007.3:g.45699G>C |
Context nucleotide sequence:
GAAGAAAGAGAAAAAAATAAGCTTC [C/G] GTGTTCAGTGGATTAGAAACCATGT (Strand: -)
Also known as:
Comments: Associated with HbF levels in the general (non-anaemic) population of Sardinia (n=4305). Associated with HbF levels and disease severity in patients from Thailand with HbE/β0-thalassemia. Associated with higher levels of serum uric acid in African Americans (n=1976).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] Hyperuricemia [HP:0002149] Severity [HP:0012824] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 45699 |
Size: | 1 bp |
Located at: | HBG1-HBG2 |
Specific Location: | N/A |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Thai, Sardinian, African American |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Uda M, Galanello R, Sanna S, Lettre G, Sankaran VG, Chen W, Usala G, Busonero F, Maschio A, Albai G, Piras MG, Sestu N, Lai S, Dei M, Mulas A, Crisponi L, Naitza S, Asunis I, Deiana M, Nagaraja R, Perseu L, Satta S, Cipollina MD, Sollaino C, Moi P, Hirschhorn JN, Orkin SH, Abecasis GR, Schlessinger D, Cao A, Genome-wide association study shows BCL11A associated with persistent fetal hemoglobin and amelioration of the phenotype of beta-thalassemia., Proc. Natl. Acad. Sci. U.S.A. , 105(5), 1620-5, 2008
- Sherva R, Sripichai O, Abel K, Ma Q, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Svasti S, Fucharoen S, Braun A, Farrer LA, Genetic modifiers of Hb E/beta0 thalassemia identified by a two-stage genome-wide association study., BMC Med. Genet. , 11(0), 51, 2010
- Shriner D, Kumkhaek C, Doumatey AP, Chen G, Bentley AR, Charles BA, Zhou J, Adeyemo A, Rodgers GP, Rotimi CN, Evolutionary context for the association of γ-globin, serum uric acid, and hypertension in African Americans., BMC Med. Genet. , 16(0), 103, 2015
Created on 2016-05-16 18:36:20,
Last reviewed on 2021-07-08 16:32:30 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-05-16 18:36:20 | The IthaGenes Curation Team | Created |
2 | 2016-06-06 15:33:52 | The IthaGenes Curation Team | Reviewed. |
3 | 2016-09-12 13:17:06 | The IthaGenes Curation Team | Reviewed. Comment updated. Clinical phenotype added. |
4 | 2021-07-08 16:32:30 | The IthaGenes Curation Team | Reviewed. Phenotype added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-18 10:10:45