IthaID: 2816
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs10837631 | HGVS Name: | NG_000007.3:g.72490A>T |
Context nucleotide sequence:
TTATCCTGCATCTCTCAGCCTTG [A>T] CTCCACTCAGTTCTCTTGCTTAG (Strand: -)
Also known as:
Comments: Variant associated with HbF levels in patients from Thailand with HbE/β0-thalassemia, who were classified as clinically mild for the disease (n=207). It also identifies the RFLP site HinfI in the beta-globin gene cluster for the characterization of βS haplotypes (Benin, Bantu, Senegal, Cameroon, Arab-Indian).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 72490 |
Size: | 1 bp |
Located at: | β |
Specific Location: | N/A |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Thai |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Ma Q, Abel K, Sripichai O, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Fucharoen S, Braun A, Farrer LA, Beta-globin gene cluster polymorphisms are strongly associated with severity of HbE/beta(0)-thalassemia., Clin. Genet. , 72(6), 497-505, 2007
- Shaikho EM, Farrell JJ, Alsultan A, Qutub H, Al-Ali AK, Figueiredo MS, Chui DHK, Farrer LA, Murphy GJ, Mostoslavsky G, Sebastiani P, Steinberg MH, A phased SNP-based classification of sickle cell anemia HBB haplotypes., BMC Genomics, 18(1), 608, 2017
Created on 2016-05-17 10:57:04,
Last reviewed on 2020-04-22 14:09:58 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-05-17 10:57:04 | The IthaGenes Curation Team | Created |
2 | 2020-04-22 14:09:58 | The IthaGenes Curation Team | Reviewed. Strand orientation and Context sequence corrected. Comment updated. Reference added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-03-28 09:17:36