
IthaID: 2844
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs55731938 | HGVS Name: | NC_000006.12:g.135093712G>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GTCCATGTGTACATAAAGACTACTC [A/G] TTGCATTAATTATTTCATCCTTAGA (Strand: +)
Comments: SNP associated with HbF levels in individuals from Tanzania with sickle cell disease (n=1022).
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 6 |
|---|---|
| Locus: | NT_025741.15 |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | HBS1L-MYB |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Tanzanian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Mtatiro SN, Mgaya J, Singh T, Mariki H, Rooks H, Soka D, Mmbando B, Thein SL, Barrett JC, Makani J, Cox SE, Menzel S, Genetic association of fetal-hemoglobin levels in individuals with sickle cell disease in Tanzania maps to conserved regulatory elements within the MYB core enhancer., BMC Med. Genet. , 16(0), 4, 2015
Created on 2016-05-17 15:18:30,
Last reviewed on 2018-11-20 19:34:58 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.