IthaID: 2847

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs11321816 HGVS Name: NC_000006.12:g.135097900C>A

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TTATTTACAGTTTTTTCACAAGCAA [C>A] CCTGCTGTATTTCTGTGCACAGATA (Strand: +)

Comments: rs148201067 (A) associated with elevated HbF levels in β-thalassaemia patients from China (Guanxi province) [PMID: 27835778], as well as in a sickle cell anaemia cohort from Tanzania [PMID: 25928412].

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 6
Locus: NT_025741.15
Locus Location: N/A
Size: 1 bp
Located at: HBS1L-MYB
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Tanzanian, Chinese
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Mtatiro SN, Mgaya J, Singh T, Mariki H, Rooks H, Soka D, Mmbando B, Thein SL, Barrett JC, Makani J, Cox SE, Menzel S, Genetic association of fetal-hemoglobin levels in individuals with sickle cell disease in Tanzania maps to conserved regulatory elements within the MYB core enhancer., BMC Med. Genet. , 16(0), 4, 2015
  2. Yi S, Lai Y, Zuo Y, Chen Y, Qin H, Wei Y, Yang Q, Lin L, Luo J, Fan X, Zheng C, Common genetic polymorphisms at three loci affect HbF levels in β-thalassemia patients from Southern China., Blood Cells Mol. Dis. , 62(0), 22-23, 2016
Created on 2016-05-17 15:27:01, Last reviewed on 2019-05-23 14:16:09 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.