
IthaID: 2909
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs11969912 | HGVS Name: | NG_008107.1:g.149950C>T |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TTTTGAGGGACATCTGTTGACAGGC [A/G] GTGGTGCACCTAAGTTCTAATGCAG (Strand: +)
Comments: SNP associated with priapism in male patients with sickle cell disease (n=199).
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Priapism [HP:0200023] [OMIM:176620] |
Location
| Chromosome: | 6 |
|---|---|
| Locus: | NG_008107.1 |
| Locus Location: | 149950 |
| Size: | 1 bp |
| Located at: | F13A1 |
| Specific Location: | Intron 11 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Elliott L, Ashley-Koch AE, De Castro L, Jonassaint J, Price J, Ataga KI, Levesque MC, Brice Weinberg J, Eckman JR, Orringer EP, Vance JM, Telen MJ, Genetic polymorphisms associated with priapism in sickle cell disease., Br. J. Haematol. , 137(3), 262-7, 2007
Created on 2016-05-23 15:30:53,
Last reviewed on 2016-05-23 15:32:02 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.