
IthaID: 2915
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | -840 G>A | HGVS Name: | NC_000004.12:g.69095621G>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ccaaataactgtgaggaagtgagtc [A/G ] gagaacaagctaacctaatgattaa (Strand: +)
Comments: The presence of the UGT2B7 -840G allele associated with reduced morphine glucuronidation in sickle cell disease (SCD) patients, thereby contributing to the variability in hepatic clearance of morphine in SCD.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Morphine glucuronidation |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Darbari DS, van Schaik RH, Capparelli EV, Rana S, McCarter R, van den Anker J, UGT2B7 promoter variant -840G>A contributes to the variability in hepatic clearance of morphine in patients with sickle cell disease., Am. J. Hematol. , 83(3), 200-2, 2008
Created on 2016-05-24 12:06:44,
Last reviewed on 2019-07-03 21:46:21 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.