IthaID: 2923
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1800795 | HGVS Name: | NG_011640.1:g.4880C>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ACTTTTCCCCCTAGTTGTGTCTTGC [C/G] ATGCTAAAGGACGTCACATTGCACA (Strand: +)
Comments: The -174G>C polymorphism associated with leg ulcers in sickle cell anaemia (SCA) patients from Brazil [PMID: 25595815]. SNP (G allele) associated with a lower risk of stroke in SCA patients from Brazil [PMID: 28542795].
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Leg ulcers [OMIM:150590] Stroke [HP:0001297] [OMIM:601367] |
Location
| Chromosome: | 7 |
|---|---|
| Locus: | NG_011640.1 |
| Locus Location: | 4880 |
| Size: | 1 bp |
| Located at: | IL6 |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Brazilian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Vicari P, Adegoke SA, Mazzotti DR, Cançado RD, Nogutti MA, Figueiredo MS, Interleukin-1β and interleukin-6 gene polymorphisms are associated with manifestations of sickle cell anemia., Blood Cells Mol. Dis. , 54(3), 244-9, 2015
- Domingos IF, Pereira-Martins DA, Coelho-Silva JL, Borges-Medeiros RL, Falcão DA, Azevedo RC, Anjos AC, Costa FF, Mendonça TF, Cavalcanti MS, Araujo AS, Lucena-Araujo AR, Bezerra MA, Interleukin-6 G-174C polymorphism predicts higher risk of stroke in sickle cell anaemia., Br. J. Haematol. , 2017
Created on 2016-05-26 12:07:14,
Last reviewed on 2017-07-19 10:54:56 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.